Abstract
Supplementary figures to: Kienesberger, Klemens, Aniko Pordes, Thomas Völk, and Reinhold Hofbauer. 2014. “L-Carnitine and PPARα-Agonist Fenofibrate Are Involved in the Regulation of Carnitine Acetyltransferase (CrAT) mRNA Levels in Murine Liver Cells.” BMC Genomics 15 (1): 514. doi:10.1186/1471-2164-15-514.
Figure S1:
qPCR of human PPP2R4 from the human liver cell line HepG2: (A) cells were treated 24 h with dialyzed FCS and supplemented afterwards for 4 hours with L-carnitine (80 μM). Values show mean SD, n = 4, ***p < 0.001 vs. DMEM + 10% FCS. (B) Cells were grown in DMEM + 10%FCS for 24 hours and afterwards treated with fenofibrate (10–40 μM) for four hours. Values represent means ± SD (n = 4). Supplemented cultures were compared to physiological control (DMEM + 10% FCS) ***p < 0.001. Methods: Human liver cell line HepG2 was treated as described in the methods section for TIB-73 cells. For quantitative PCR given protocols as described in the methods sections were followed. Following primers were used: PPP2R4 Ps: 5′CAAGAGTGAAAGGCGAGACG3′, Pas:5′CCATGTCTGGAACTGTGTGG′; ß-actin Ps: 5′GATGAGTATGCCTGCCGTGTG3′, Pas: 5′TCAACTGGTCTCAA-GTCAGTG3′. Figure S2. Electrophoretic mobility super shift assay with anti-RXRα and anti-PPARγ: Nuclear extracts from TIB-73 cells supplemented with increasing concentrations of L-carnitine were incubated with -32P-labeled oligonucleotides representing the RXRα-binding site with anti-RXRα and anti-PPAR as indicated. No mitigation effect was observable as seen with anti-PPARα antibodies in Figure 5. Figure S3. Electrophoretic mobility shift assay of one of the CrAT promoter GR-binding sites: Nuclear extracts from TIB-73 cells supplemented with increasing concentrations of L-carnitine were incubated with a -32P-labeled oligonucleotide representing the GR-binding site sense: 5′ GTCAACAGTTGTGTTCTCCTGCCATTC3′.